Contact Us : +86(027) 5111 3188  /  info@servicebio.com

Pipette Tips

Gene  Species & genus Cat.no Serial No. Primer name Serial(5'-3') Length Spec.
a-SMA H GYW00018 NM_001141945.2 H-α-SMA-S
H-α-SMA-A
CAATGTCCTATCAGGGGGCAC
CGGCTTCATCGTATTCCTGTT
209 1OD
FOXP3 M GYW00006 NM_001199347.1 M-FOXP3-S
M-FOXP3-A
AGAGCCCTCACAACCAGCTA
CCAGATGTTGTGGGTGAGTG
209 1OD
IFNG R GYW00013 NM_138880.2 R-IFNG-S
R-IFNG-A
GGTGAACAACCCACAGATCCAG
CTTTTCCGCTTCCTTAGGCTAG
96 1OD
MYD88 M GYW00008 NM_010851 M-MYD88-S
M-MYD88-A
TGACCCCACTCGCAGTTTGT
TTTGTTTGTGGGACACTGCTTTC
222 1OD
NLRP3 M GYW00009 NM_001359638.1 M-NLRP3-S
M-NLRP3-A
TAAGAACTGTCATAGGGTCAAAACG
GTCTGGAAGAACAGGCAACATG
146 1OD
p38 M GYW00010 NM_001168508.1 M-p38-S
M-p38-A
TGAGCCTGTTGCTGACCCTTAT
CAGGTGCTCAGGACTCCATTTC
143 1OD
TF H GYW00056 NM_001063.4 H-TF-S
H-TF-A
CCACAGAACACTGGGGGAAA
CCAGGTGGCAGTTCGCATA
124 1OD
TGFB1 H GYW00055 NM_000660.7 H-TGFB1-S
H-TGFB1-A
CAGCAACAATTCCTGGCGATA
GCTAAGGCGAAAGCCCTCAAT
139 1OD
TGFB3 H GYW00054 NM_001329938.1 H-TGFB3-S
H-TGFB3-A
GAAGAGGGTGGAAGCCATTAGG
TAGGGCAGACAGCCAGTTCGT
263 1OD
TGFBR1 H GYW00053 NM_001130916.3 H-TGFBR1-S
H-TGFBR1-A
ATCCTTCAAACGTGCTGACATC
TGCCTTCCTGTTGACTGAGTTG
320 1OD
TGFBR3 H GYW00052 NM_001195683.2 H-TGFBR3-S
H-TGFBR3-A
TGGTGTCTGAGGGTTCTGTGG
TTCTTGCTATCTTGAGTTCGGTG
163 1OD
TIMP1 H GYW00051 NM_003254.3 H-TIMP1-S
H-TIMP1-A
CAATTCCGACCTCGTCATCAG
GGTTGTGGGACCTGTGGAAGTA
197 1OD
TIMP2 H GYW00050 NM_003255.4 H-TIMP2-S
H-TIMP2-A
AAGGAAGTGGACTCTGGAAACG
CTCTTCTTCTGGGTGGTGCTCA
272 1OD
timp3 H GYW00049 NM_000362.5 H-timp3-S
H-timp3-A
TGCTGACAGGTCGCGTCTATG
GGCAGGTAGTAGCAGGACTTGATC154
154 1OD
TLR2 H GYW00047 NM_003264.3 H-TLR2-S
H-TLR2-A
TTGTGACCGCAATGGTATCTG
GTTGTTGGACAGGTCAAGGCT
100 1OD
TLR4 H GYW00046 NM_003266.3 H-TLR4-S
H-TLR4-A
TCCCTCCAGGTTCTTGATTACAG
GCCCTGCTTATCTGAAGGTGTT
219 1OD
TLR5 H GYW00045 NM_003268.6 H-TLR5-S
H-TLR5-A
AACTTTAGCAATGCCATCAGC
TGGAGGTTGTCAAGTCCGTAA
284 1OD
TLR6 H GYW00044 NM_006068.5 H-TLR6-S
H-TLR6-A
TGACATGAGCTTTCTATCAGAGTTG
CAGCTTCATAGCACTCAATCCC
265 1OD
TLR9 H GYW00043 NM_017442.4 H-TLR9-S
H-TLR9-A
ACTGGCTGTTCCTGAAGTCTGTG
CAGGTTTAGCTCTTCCAGGGTG
254 1OD
TMEM26 H GYW00042 NM_178505.8 H-TMEM26-S
H-TMEM26-A
GCTGCTCAACCTCTTGCTCTT
CTTTTCTGCTGGTATTCTGTGATG
200 1OD
Contact us

Quick Links

Product Category

2022 AACC See You in Chicago

Get In Touch

 5th Floor, 22 Building, Biopark, Gaoxin 2nd Road No. 388, East Lake High-Tech Developing Zone, Wuhan, Hubei, China 430079
 +86(027) 5111 3188
Copyright © 2021  Wuhan Servicebio Technology Co., Ltd.